|
Addgene inc
ms2 stem Ms2 Stem, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ms2 stem/product/Addgene inc Average 93 stars, based on 1 article reviews
ms2 stem - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
p stl1- 24xms2sl ![]() P Stl1 24xms2sl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p stl1- 24xms2sl/product/Addgene inc Average 90 stars, based on 1 article reviews
p stl1- 24xms2sl - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Eurofins
wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops ![]() Wildtype Or Mutant (Ggagcagacgatggcgtcgctcc) Pp7 Stem–Loops, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops/product/Eurofins Average 90 stars, based on 1 article reviews
wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmids containing different increments ms2 pp7 stem-loops ![]() Plasmids Containing Different Increments Ms2 Pp7 Stem Loops, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmids containing different increments ms2 pp7 stem-loops/product/Addgene inc Average 90 stars, based on 1 article reviews
plasmids containing different increments ms2 pp7 stem-loops - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pp7 stem ![]() Pp7 Stem, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pp7 stem/product/Addgene inc Average 91 stars, based on 1 article reviews
pp7 stem - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Addgene inc
backbone expressing three ms2 stem-loops ![]() Backbone Expressing Three Ms2 Stem Loops, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/backbone expressing three ms2 stem-loops/product/Addgene inc Average 90 stars, based on 1 article reviews
backbone expressing three ms2 stem-loops - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
r26-5’cast1.1-caccgagtggggtcgactatctgaaggg ![]() R26 5’cast1.1 Caccgagtggggtcgactatctgaaggg, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r26-5’cast1.1-caccgagtggggtcgactatctgaaggg/product/Oligos Etc Average 90 stars, based on 1 article reviews
r26-5’cast1.1-caccgagtggggtcgactatctgaaggg - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
mcherry or mvenus fluorescent proteins ![]() Mcherry Or Mvenus Fluorescent Proteins, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mcherry or mvenus fluorescent proteins/product/Addgene inc Average 90 stars, based on 1 article reviews
mcherry or mvenus fluorescent proteins - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pp7 binding proteins ![]() Pp7 Binding Proteins, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pp7 binding proteins/product/Addgene inc Average 90 stars, based on 1 article reviews
pp7 binding proteins - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
dcas9 ![]() Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dcas9/product/Addgene inc Average 91 stars, based on 1 article reviews
dcas9 - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a Schematics of the transcriptional response induced by the MAPK Hog1 upon osmotic stress. Under normal growth conditions, the genomic locus is repressed by histones set in place by the Ino80 complex and Asf1/Rtt109. In addition, H3K4 methylated histones mediated by Set1 contribute to the further repression of the locus (upper panel). When Hog1 is active (lower panel), it accumulates in the nucleus with the transcription factors Msn2/4. Hog1 binds to the transcription factors Hot1 and Sko1, allowing the remodeling of the chromatin by Rpd3 and the SAGA complex. The polymerases can be recruited to the locus and the RSC and SWR complexes evict nucleosomes on the ORF. b Construction of the transcriptional reporter. The promoter of interest (p PROM ) is cloned in front of 24 stem-loops ( 24xPP7sl ). This construct is transformed in yeast and integrated in the GLT1 locus 5′UTR, replacing the endogenous promoter. Upon induction of the promoter of interest, the mRNA stem-loops are transcribed and recognized by the fluorescently-tagged PP7 phage coat proteins. c Maximum intensity projections of Z-stacks of microscopy images from the p STL1 -PP7sl reporter system in a 0.2 M NaCl osmotic stress time-lapse experiment. The appearance of bright foci (arrow heads) in the nucleus of the cells denotes the active transcription arising from the promoter. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Dynamics of the p STL1 -PP7sl transcription site intensity (20 brightest pixels in the nucleus minus the median fluorescence of the cell) following hyperosmotic stress. The mean of the population is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: 0.0 M: 313; 0.1 M: 404; 0.2 M: 229; 0.3 M: 201. e Analysis of one representative single-cell trace. The raw trace (gray) is smoothed with a moving average (dark blue) and normalized by subtracting the intensity of the first time point after the stimulus. Multiple quantitative values can be extracted from this trace (see Methods). Source data are provided for d .
Article Snippet: The
Techniques: Methylation, Clone Assay, Construct, Transformation Assay, Microscopy, Fluorescence
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a Dynamics of the transcription site intensity from six different promoters following a 0.2 M NaCl stress. The mean of at least 140 cells is represented by the solid line. The shaded areas represent the s.e.m. Number of cells for each trace: p ALD3 : 171; p CTT1 : 140; p STL1 : 229; p GRE2 : 289; p HSP12 : 243; p GPD1 : 335. b Percentage of cells where a PP7 TS site was detected. The light shaded area represents the percentage of PP7 positive cells before the stimulus was added (basal transcription). c The microscopy thumbnails display cells bearing the p GPD1 -PP7sl reporter system, where transcription sites (arrow heads) can be detected before and after the stress of 0.2 M NaCl. Scale bar represents 5 µm. Representative images from at least three biological replicates. d Cumulative distribution function (CDF) of the Start Time for each promoter considering only the cells that induce transcription after time zero. e 10th, 50th and 90th percentiles of the Start Times shown for the two to three replicates measured for each promoter. f Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain in wild type, htz1∆ or gcn5∆ backgrounds. The inset shows the percentage of PP7 positive cells in each background. g Cumulative distribution functions of Start Times for the p STL1 -PP7sl strain grown in glucose or raffinose. The inset shows the percentage of PP7 positive cells, the light blue bar the basal positive PP7 cells. Source data are provided for a , f , and g .
Article Snippet: The
Techniques: Microscopy
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a In Hog1 nuclear relocation traces obtained from single cells, the timing of Hog1 nuclear entry (square), maximum enrichment (circle), start of the decay in nuclear enrichment (diamond) and Hog1 adaptation (triangle) can be identified (upper panel). The median (marker) and 25th to 75th percentiles (lines) for these measurements performed on a population of more than 300 cells are plotted for three different osmotic stresses (central panel). The cumulative distribution functions of Start Times for the p STL1 -PP7sl reporter for these same three concentrations are plotted (lower panel). b Histograms of Start Times following a 0.2 M stress for the five other promoters tested. The vertical dashed line represents the median decay time of Hog1 measured at 0.2 M. The number in the legend indicates the percentage of cells, which have initiated transcription before the median Hog1 decay time. c The population of p STL1 -PP7sl positive cells is split in four quartiles based on their Start Time. The median (circle) and 25th to 75th percentiles (line) of the integral of the PP7 trace is plotted for each quartile of at least 50 cells. Source data are provided for a .
Article Snippet: The
Techniques: Marker
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a Violin plots of the trace intensity (maximum of the TS during the transcription period) for the six promoters after stimulation by 0.2 M NaCl. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b Comparison between the trace intensity in stimulated (0.2 M NaCl) and unstimulated conditions (0.0 M) for the three promoters displaying basal expression. c .– f Effects of the deletions of the HOT1 and SKO1 transcription factor genes on p STL1 and p GPD1 dynamics of transcription ( c , the solid lines represent the mean of the population and the shaded areas represent the s.e.m.), cumulative distribution functions of Start Times ( d ), the trace intensity ( e ) and the percentage of responding cells ( f ) for the p STL1 -PP7sl and p GPD1 -PP7sl reporter strains following a 0.2 M NaCl stress for at least 200 cells. For the p STL1 -PP7sl hot1∆ sample, 349 cells were analyzed with only 9 displaying a PP7 TS signal. This low number does not allow to draw a meaningful CDF curve in d . Source data are provided for b and c .
Article Snippet: The
Techniques: Comparison, Expressing
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a Percentage of cells where 1, 2, and 3 or more peaks (1P, 2P, ≥3P, respectively) are identified among the population of responding cells for the different promoters following a 0.2 M NaCl stress. b Examples of single-cell traces displaying 1 or 2 peaks (1P, 2P) for the p STL1 -PP7sl and the p GPD1 -PP7sl reporter strains. c . Violin plots representing the Peak Duration. Each dot represents the value calculated for a single peak. The solid line is the median and the dashed line the mean of all the peaks measured. d – e The population of cells was split between cells displaying one peak (1P) and two or more peaks (≥2P). The Peak Duration ( d ) and Trace Intensity ( e ) are plotted for the p HSP12 -PP7sl and p GPD1 -PP7sl strains. Each dot represents the value calculated for a single peak ( d ) or a single cell ( e ). The solid line is the median and the dashed line the mean of the population.
Article Snippet: The
Techniques:
Journal: Nature Communications
Article Title: Single-particle imaging of stress-promoters induction reveals the interplay between MAPK signaling, chromatin and transcription factors
doi: 10.1038/s41467-020-16943-w
Figure Lengend Snippet: a Violin plots representing the Transcription Period (time difference between End Time and Start Time) measured for the p STL1 -PP7sl reporter following 0.1, 0.2, and 0.3 M NaCl stresses. Each dot represents the value calculated from a single cell. The solid line is the median and the dashed line the mean of the population. b One minus the cumulative distribution function of End Times for the p STL1 -PP7sl reporter. The vertical dashed lines represent the median adaptation time of Hog1 for the three different stress levels. c Dynamics of the estimated NaCl concentrations in the medium for the pulse, step, and ramp experiment protocols (upper panel, Methods). Corresponding Hog1 relocation dynamics (middle panel) and p STL1 -PP7sl transcription site intensity (lower panel). The mean of at least 180 cells is represented by the solid line. The shaded areas represent the s.e.m. d Cumulative distribution function (CDF) of the Start Time for all cells in the pulse, step, and ramp experiments. The CDF at 15 min represents the fraction of responding cells for each condition. e One minus the cumulative distribution function of End Times only for the responding cells in the pulse, step, and ramp experiments. f Correlation between the Hog1 adaptation time and the PP7 End Time measured in the same cells in the pulse, step, and ramp experiments. The open markers indicate cells where Hog1 has not adapted at the end of the time lapse. Adaptation time is arbitrarily set to 35 min for this sub-population. Source data are provided for c .
Article Snippet: The
Techniques:
Journal: Nucleic Acids Research
Article Title: Visualization and characterization of RNA–protein interactions in living cells
doi: 10.1093/nar/gkab614
Figure Lengend Snippet: Development of the RNA fluorescence three-hybrid assay (rF3H) for RNA–protein interaction studies. ( A ) Principle of the rF3H assay. Three components for the assay, RNA of interest, protein of interest and an RNA trap, are triply expressed in cells containing lacO array on the genome. Tagged with ms2 stem–loop structures, the RNA of interest is recruited and anchored to the lacO loci by the RNA trap, the protein of interest therefore is enriched at the lacO loci by interacting with the RNA of interest, and the interaction between the protein and RNA can be visualized as co-localization of the fused red and green fluorescent proteins. ( B ) Image examples of pp7 RNA-PCP interaction visualized by rF3H. The RNA trap marked by EGFP was anchored at the lacO array and visualized as a nuclear fluorescent spot (EGFP channel, marked by filled arrowhead), and the mCherry labeled PCP (PCP-mCherry) was recruited to the lacO spot specifically in the presence of pp7 RNA (lower panel, marked by filled arrowhead), but neither in the mutant pp7 group nor in the control group (mCherry channel of the upper and middle panels, marked by open arrowhead). Merge channels were enhanced for clarity purposes. Scale bars are 10 μm. ( C ) Quantification of the relative mCherry signal at the lacO array. The presence of pp7 RNA leads to a significant fluorescence enhancement at the lacO spot compared with no RNA or only ms2 RNA condition. Data are presented as mean ± S.D., -RNA, n = 23; +ms2, n = 25; +ms2-pp7, n = 24, +ms2-pp7m, n = 26. *** P < 0.001.
Article Snippet: After that, 4 of 6 times ms2 stem–loops were replaced by 4 times of wildtype or mutant (GGAGCAGACGATGGCGTCGCTCC, synthesized by
Techniques: Fluorescence, Hybrid Assay, Labeling, Mutagenesis, Control